DNA Sequencing Facility

Sample Submission Form

Overview:

  • High throughput, automated DNA sequencing services are currently provided for by the use of the state of the art Applied Biosystems 3730 DNA Analyzer. This capillary based instrument has the capability to run up to 48 samples in one run with read lengths of greater that 1,000 bases (PHRED Q20 scores >800) within 2 hours.
  • Big Dye Terminator (BDT) v 3.1 Chemistry is currently in use. This chemistry is an improvement upon the original BDT v 3.0 chemistry in that it allows the operator to achieve longer read lengths, even in the presence of G rich templates. Several cycle sequencing optimization strategies are available at the OGC DNA Sequencing Facililty for problematic templates. Consultations for large projects or difficult templates are available upon request.

Equipment:

  • Applied Biosystems 3730 DNA Analyzer
  • MJ Research Tetrad Thermocyclers

Services Provided:

  • Fluorescent DNA sequencing of plasmids, PCR products, cosmids, Phage, BAC, and Genomic DNA
  • SNP Analysis
  • Methylation Status Detection
  • Primer Walking Projects including Primer Design, Contig Assembly and Consensus Sequence Generation
  • High Throughput DNA Sequencing Projects

Please contact Atieh Jalali-Pakdaman or Pearl Campbell for more information regarding the services provided, or to discuss options for high throughput analysis.

Sample Preparation:

    As the Applied Biosystems 3730 DNA Analyzer has an increased magnitude of sensitivity over previous models of sequencers, results obtained with this instrument are highly dependent upon both template quality and quantity. The single most important determinant of a successful sequencing reaction is the presence of a high quality template. DNA that is suitable for restriction analysis or manual DNA sequencing may not produce optimal results with the 3730. Here are some points to consider:

    • The two most common contaminants that will adversely affect your results are EDTA and salt. All sequencing templates submitted should be prepared using a high quality isolation protocol (Qiagen and Millipore methods recommended). Additionally, all templates should be resuspended in either MilliQ H2O, or 10 mM Tris-HCl pH 8.0. For long-term storage, 10 mM Tris is recommended.
    • The following list comprises contaminants that may be present in a sequencing template along with the final amounts that may be tolerated in the reaction:

     

    Contaminant Final Amount Tolerated
    RNA 1.0 µg
    PEG 0.3%
    NaOAC 0.5 mM
    Ethanol 1.25%
    Phenol 0%
    CsCl 5.0 mM
    EDTA 0.1 mM
    Detergents (SDS, Triton X-100) 0%
    • DNA quantity can also affect the quality of your- sequencing results. Insufficient amounts of DNA template can produce reactions that generate signals that are far too low to be interpreted by the analysis software. This will be evidenced by a reduced overall peak height with concomitant inability of the software to make a call at low intensity base positions. Conversely, templates that are provided at too high a concentration can result in data that is top heavy. That is, high signal will be observed at the beginning of the sequence, followed by a gradual decrease in peak height due to depletion of the fluorescently labelled ddNTPs. Fluorometric or spectrophotometric determination of template concentration is strongly recommended.
    • PCR fragments should be gel purified to ensure that all non-specific bands and primers are removed.

    Reaction Submission Format:

    Templates may be submitted to the facility between the hours of 8:00 am and 3:30 pm. The samples and request forms should be placed in the designated cooler inside Lab EI 5132 in the new Sprott Centre for Stem Cell Research. In order to minimize error and reduce turnaround time we will only accept samples that are provided in the following format:

    • Each reaction should be provided in a separate 1.5 ml microfuge tube.
    • The microfuge tube should clearly be labelled with black indelible ink with the sample name (template name + primer name, please limit to 12 characters in total length) as well as the requestor’s initials.
    • Please ensure that the name on the microfuge tube corresponds exactly to the name indicated on the request form.
    • Reactions that require standard primers (provided by the Sequencing Facility) need to be provided at the concentration and amounts indicated for each template type. A separate template submission (separate microfuge tube) is required for each standard primer requested.
    • Reactions that require custom primers (provided by the customer) need to be provided with the template and the primer pre-mixed in the same microfuge tube in the amounts indicated below for each template type.
    • Samples from external sources should be shipped to the above mailing address via Federal Express or Purolator.
    • All samples are processed on a first come first served basis.
    • Laboratories will be charged for all reactions processed barring any technical issues encountered. For quality assessment purposes, one pGem control reaction will be included on each sequencing run. Periodic repeats of failed reactions will be performed to confirm the results.
    • Results can generally be obtained within 2 working days from date of submission and will be forwarded by email.
    • When your reactions have been completed you will receive an email containing both your sequencing text files (simple text format) and your electropherogram files. A colour printout may be requested for an additional charge of $2.00 per printout.

    Researchers that require higher throughput sequencing may also submit their samples in 96 well plate format. Please contact Atieh Jalali-Pakdaman or Pearl Campbell to inquire.

    Reaction Specifications:

 

Template Type Template Concentration (ng/µl) Template Volume (µl) Custom Primer Concentration(µM) Custom Primer Volume (µl)
PCR 1 10 2 5
Plasmid 12.5 10 2 5
Cosmid, Lambda Phage 50 12 2 8
BAC, Genomic DNA 100 12 2 8

Fees:

  • Academic Investigators will be charged $12.00 per reaction
  • Commercial Investigators will be charged $25.00 per reaction
  • Higher throughput sequencing is also available in 96 well PCR plate format. Please contact Atieh Jalali-Pakdaman (ajalalipakdaman@ohri.ca) for pricing and specifications.

 

Primer Specifications:

The DNA Sequencing Facility provides the standard primers listed below free of charge. Additional primers may be added to this list upon request. Please inquire.

  • pUC/M13 Forward 5’{CGC CAG GGT TTT CCC AGT CAC GAC}3’
  • pUC/M13 Reverse 5’{TCA CAC AGG AAA CAG CTA TGA C}3’
  • SP6 5’{GAT TTA GGT GAC ACT ATA G}3’
  • T3 5’{ATT AAC CCT CAC TAA AGG GA}3’
  • T7 Promoter 5’{TAA TAC GAC TCA CTA TAG GG}3’
  • T7 Terminator 5’{GCT AGT TAT TGC TCA GCG G}3’
  • PGK Promoter 5'-3' {TTT GCT CCT TCG CTT TCT}
  • EGFP-N 5'{CGT CGC CGT CCA GCT CGA CCA G}3'
  • EGFP-C 5'{CAT GGT CCT GCT GGA GTT CGT G}3'
  • CMV Forward 5'{AAA TGG GCG GTA GGC GTG}3'
  • BGH Reverse 5'{TAG AAG GCA CAG TCG}3'
  • SV40 Reverse 5'{GCG GGA CTA TGG TTG CTG AC}3'
  • T20VN 5'{TTT TTT TTT TTT TTT TTT TTV N}
  • (-21)M13F  TGTAAAACGACGGCCAGT
  • pFastBac Fwd TATTCCGGATTATTCATACCGTC
  • pFastBac Rev GTATGGCTGATTATGATCCTC

Custom Primer Design:

The choice of sequencing primer, method of primer synthesis, and approach to primer purification can have a significant effect on the quality of the sequencing data. The following list provides relevant considerations in sequencing primer design:

  • Primers should be between 18-24 bases long to ensure good hybridization
  • The GC content should range from 40-60%
  • Primer Tm should be between 50-60 °C
  • Primer design should only occur in regions of unambiguous sequence
  • Avoid homopolymeric regions in primer design. This is especially true of G rich regions as they can form secondary structures.
  • The use of software for primer design is strongly recommended. Several good primer design websites exist and include:


Mailing Address:

Ottawa Hospital Research Institute
Sprott Center for Stem Cell Research
StemCore Laboratories
Room 5132, Critical Care Wing
501 Smyth Road
Ottawa, Ontario, Canada K1H 8L6
 
 

Contact Information:

Atieh Jalali-Pakdaman
ajalalipakdaman@ohri.ca
613.737.8899 x73251 (lab phone)
613.739.6294 (fax)